Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 111416
• Name: oriT_Gp169|unnamed
• Organism: Yersinia enterocolitica strain Gp169
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP107096 (2710..2767 [-], 58 nt)
• oriT length: 58 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 58 nt

>oriT_Gp169|unnamed
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 11851
• GenBank: NZ_CP107096
• Plasmid name: Gp169|unnamed
• Incompatibility group: ColRNAI
• Plasmid size: 3300 bp
• Coordinate of oriT [Strand]: 2710..2767 [-]
• Host baterium: Yersinia enterocolitica strain Gp169

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -