Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111406 |
| Name | oriT_pST1030-2B  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MT507883 (2525..2584 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pST1030-2B
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11841 | GenBank | NZ_MT507883 |
| Plasmid name | pST1030-2B | Incompatibility group | ColRNAI |
| Plasmid size | 25900 bp | Coordinate of oriT [Strand] | 2525..2584 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium |
Cargo genes
| Drug resistance gene | sul3, ant(3'')-Ia, cmlA1, aadA2, dfrA12 |
| Virulence gene | - |
| Metal resistance gene | merR, merT, merP, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |