Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111404
Name   oriT_p33.1_4 in_silico
Organism   Pantoea agglomerans strain 33.1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP083812 (583..642 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p33.1_4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11839 GenBank   NZ_CP083812
Plasmid name   p33.1_4 Incompatibility group   Col440II
Plasmid size   4460 bp Coordinate of oriT [Strand]   583..642 [+]
Host baterium   Pantoea agglomerans strain 33.1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -