Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 111399 |
Name | oriT_pF27I |
Organism | Lactococcus cremoris strain F.2.7 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP068518 (1059..1094 [+], 36 nt) |
oriT length | 36 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_pF27I
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 11834 | GenBank | NZ_CP068518 |
Plasmid name | pF27I | Incompatibility group | - |
Plasmid size | 2064 bp | Coordinate of oriT [Strand] | 1059..1094 [+] |
Host baterium | Lactococcus cremoris strain F.2.7 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |