Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111388 |
| Name | oriT_pSTY4-2010K-1587  |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016867 (820..877 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pSTY4-2010K-1587
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11823 | GenBank | NZ_CP016867 |
| Plasmid name | pSTY4-2010K-1587 | Incompatibility group | ColRNAI |
| Plasmid size | 3223 bp | Coordinate of oriT [Strand] | 820..877 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |