Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111382 |
| Name | oriT_pSA02DT09004001_2  |
| Organism | Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP016523 (1079..1161 [+], 83 nt) |
| oriT length | 83 nt |
| IRs (inverted repeats) | 1..6, 15..20 (GGGGTG..CACCCC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 83 nt
>oriT_pSA02DT09004001_2
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
GGGGTGTCGGGGTGCACCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11817 | GenBank | NZ_CP016523 |
| Plasmid name | pSA02DT09004001_2 | Incompatibility group | ColpVC |
| Plasmid size | 2096 bp | Coordinate of oriT [Strand] | 1079..1161 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |