Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111281 |
| Name | oriT_FDAARGOS_523|unnamed6  |
| Organism | Enterobacter roggenkampii strain FDAARGOS_523 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP033803 (1..60 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_FDAARGOS_523|unnamed6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11716 | GenBank | NZ_CP033803 |
| Plasmid name | FDAARGOS_523|unnamed6 | Incompatibility group | ColRNAI |
| Plasmid size | 4214 bp | Coordinate of oriT [Strand] | 1..60 [+] |
| Host baterium | Enterobacter roggenkampii strain FDAARGOS_523 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |