Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111273
Name   oriT_pAVS0889-e in_silico
Organism   Enterobacter cloacae isolate AVS0889
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP092047 (977..1036 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pAVS0889-e
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11708 GenBank   NZ_CP092047
Plasmid name   pAVS0889-e Incompatibility group   Col440I
Plasmid size   2454 bp Coordinate of oriT [Strand]   977..1036 [-]
Host baterium   Enterobacter cloacae isolate AVS0889

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -