Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 111238 |
Name | oriT_pRHB18-C08_3 |
Organism | Escherichia fergusonii strain RHB18-C08 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP055957 (1070..1162 [+], 93 nt) |
oriT length | 93 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 93 nt
>oriT_pRHB18-C08_3
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTTGGGG
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTTGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 11673 | GenBank | NZ_CP055957 |
Plasmid name | pRHB18-C08_3 | Incompatibility group | Col |
Plasmid size | 1551 bp | Coordinate of oriT [Strand] | 1070..1162 [+] |
Host baterium | Escherichia fergusonii strain RHB18-C08 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |