Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 111227 |
Name | oriT_pHL17078_3 |
Organism | Staphylococcus aureus strain HL17078 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP080559 (1447..1635 [-], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 133..138, 142..147 (TCTGGC..GCCAGA) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pHL17078_3
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 11662 | GenBank | NZ_CP080559 |
Plasmid name | pHL17078_3 | Incompatibility group | - |
Plasmid size | 3125 bp | Coordinate of oriT [Strand] | 1447..1635 [-] |
Host baterium | Staphylococcus aureus strain HL17078 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |