Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 111222
• Name: oriT_pCL053-2
• Organism: Shigella sonnei strain CL-053
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_OR237800 (3155..3214 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pCL053-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 11657
• GenBank: NZ_OR237800
• Plasmid name: pCL053-2
• Incompatibility group: ColRNAI
• Plasmid size: 8401 bp
• Coordinate of oriT [Strand]: 3155..3214 [+]
• Host baterium: Shigella sonnei strain CL-053

Cargo genes

• Drug resistance gene: sul2, aph(3'')-Ib, aph(6)-Id
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -