Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111216 |
| Name | oriT_SAP046B  |
| Organism | Staphylococcus aureus |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_013295 (208..396 [-], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 133..138, 142..147 (TCTGGC..GCCAGA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_SAP046B
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11651 | GenBank | NC_013295 |
| Plasmid name | SAP046B | Incompatibility group | - |
| Plasmid size | 3125 bp | Coordinate of oriT [Strand] | 208..396 [-] |
| Host baterium | Staphylococcus aureus |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |