Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111211
Name   oriT_p158G in_silico
Organism   Lactococcus cremoris strain 158
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP034596 (1059..1094 [+], 36 nt)
oriT length   36 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 36 nt

>oriT_p158G
ACCACCCAATTTTGGAGTGGTGTGTAAGTGCGCATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11646 GenBank   NZ_CP034596
Plasmid name   p158G Incompatibility group   -
Plasmid size   2064 bp Coordinate of oriT [Strand]   1059..1094 [+]
Host baterium   Lactococcus cremoris strain 158

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -