Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111210
Name   oriT_p158F in_silico
Organism   Lactococcus cremoris strain 158
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP016690 (4983..5119 [+], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_p158F
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTCCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11645 GenBank   NZ_CP016690
Plasmid name   p158F Incompatibility group   -
Plasmid size   6159 bp Coordinate of oriT [Strand]   4983..5119 [+]
Host baterium   Lactococcus cremoris strain 158

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -