Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 111103 |
| Name | oriT_p08-5333.2  |
| Organism | Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014847 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP039563 (2560..2634 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_p08-5333.2
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11538 | GenBank | NZ_CP039563 |
| Plasmid name | p08-5333.2 | Incompatibility group | ColRNAI |
| Plasmid size | 4148 bp | Coordinate of oriT [Strand] | 2560..2634 [-] |
| Host baterium | Salmonella enterica subsp. enterica serovar 14[5]12:i:- strain PNCS014847 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |