Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111075
Name   oriT_pR18.2256_3.8k in_silico
Organism   Salmonella enterica subsp. enterica serovar Agona strain R18.2256
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP100700 (813..872 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pR18.2256_3.8k
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11510 GenBank   NZ_CP100700
Plasmid name   pR18.2256_3.8k Incompatibility group   Col440I
Plasmid size   3830 bp Coordinate of oriT [Strand]   813..872 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Agona strain R18.2256

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -