Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111074
Name   oriT_pR18.0292_5.9k in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain R18.0292
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP100742 (1..54 [-], 54 nt)
oriT length   54 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 54 nt

>oriT_pR18.0292_5.9k
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11509 GenBank   NZ_CP100742
Plasmid name   pR18.0292_5.9k Incompatibility group   ColRNAI
Plasmid size   5892 bp Coordinate of oriT [Strand]   1..54 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain R18.0292

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -