Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111027
Name   oriT_pUC77E in_silico
Organism   Lactococcus lactis subsp. lactis strain UC77
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP034575 (4983..5119 [+], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      21..28, 42..49  (AAAAGGGG..CCCCTTTT)
 25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_pUC77E
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCCTTTTCAAGCCACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATATTTCCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11462 GenBank   NZ_CP034575
Plasmid name   pUC77E Incompatibility group   -
Plasmid size   6159 bp Coordinate of oriT [Strand]   4983..5119 [+]
Host baterium   Lactococcus lactis subsp. lactis strain UC77

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -