Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   111013
Name   oriT_pSA20011914.1 in_silico
Organism   Salmonella enterica subsp. salamae serovar 56:z10:enx strain SA20011914
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP029993 (147..206 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSA20011914.1
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11448 GenBank   NZ_CP029993
Plasmid name   pSA20011914.1 Incompatibility group   ColRNAI
Plasmid size   4593 bp Coordinate of oriT [Strand]   147..206 [-]
Host baterium   Salmonella enterica subsp. salamae serovar 56:z10:enx strain SA20011914

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -