Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 111006
• Name: oriT_CHC|unnamed3
• Organism: Salmonella sp. strain CHC
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_OP927717 (3898..3957 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_CHC|unnamed3
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 11441
• GenBank: NZ_OP927717
• Plasmid name: CHC|unnamed3
• Incompatibility group: ColRNAI
• Plasmid size: 4615 bp
• Coordinate of oriT [Strand]: 3898..3957 [-]
• Host baterium: Salmonella sp. strain CHC

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -