Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110984
Name   oriT_pUnnamed2 in_silico
Organism   Yersinia rochesterensis strain ATCC BAA-2637
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP032484 (1243..1302 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pUnnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11419 GenBank   NZ_CP032484
Plasmid name   pUnnamed2 Incompatibility group   Col440II
Plasmid size   4160 bp Coordinate of oriT [Strand]   1243..1302 [+]
Host baterium   Yersinia rochesterensis strain ATCC BAA-2637

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -