Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110966
Name   oriT_S11_VPH_Chula|unnamed3 in_silico
Organism   Salmonella enterica strain S11_VPH_Chula
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP121389 (3599..3759 [-], 161 nt)
oriT length   161 nt
IRs (inverted repeats)      40..45, 49..54  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 161 nt

>oriT_S11_VPH_Chula|unnamed3
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11401 GenBank   NZ_CP121389
Plasmid name   S11_VPH_Chula|unnamed3 Incompatibility group   IncQ1
Plasmid size   6477 bp Coordinate of oriT [Strand]   3599..3759 [-]
Host baterium   Salmonella enterica strain S11_VPH_Chula

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -