Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110925
Name   oriT_p36 in_silico
Organism   Ruficoccus sp. ZRK36
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP080650 (4149..4208 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p36
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   11360 GenBank   NZ_CP080650
Plasmid name   p36 Incompatibility group   ColRNAI
Plasmid size   6050 bp Coordinate of oriT [Strand]   4149..4208 [-]
Host baterium   Ruficoccus sp. ZRK36

Cargo genes


Drug resistance gene   aph(3')-Ia
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -