Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 110925
• Name: oriT_p36
• Organism: Ruficoccus sp. ZRK36
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP080650 (4149..4208 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_p36
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 11360
• GenBank: NZ_CP080650
• Plasmid name: p36
• Incompatibility group: ColRNAI
• Plasmid size: 6050 bp
• Coordinate of oriT [Strand]: 4149..4208 [-]
• Host baterium: Ruficoccus sp. ZRK36

Cargo genes

• Drug resistance gene: aph(3')-Ia
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -