Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110916 |
| Name | oriT_p30038n4  |
| Organism | Escherichia fergusonii strain 30038 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP027930 (1085..1171 [+], 87 nt) |
| oriT length | 87 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 87 nt
>oriT_p30038n4
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 11351 | GenBank | NZ_AP027930 |
| Plasmid name | p30038n4 | Incompatibility group | Col |
| Plasmid size | 1506 bp | Coordinate of oriT [Strand] | 1085..1171 [+] |
| Host baterium | Escherichia fergusonii strain 30038 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |