Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110354 |
| Name | oriT_pAlvB  |
| Organism | Hafnia alvei |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_005911 (4130..4189 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pAlvB
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGAAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGAAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10789 | GenBank | NC_005911 |
| Plasmid name | pAlvB | Incompatibility group | - |
| Plasmid size | 5216 bp | Coordinate of oriT [Strand] | 4130..4189 [+] |
| Host baterium | Hafnia alvei |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |