Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110354
Name   oriT_pAlvB in_silico
Organism   Hafnia alvei
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_005911 (4130..4189 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pAlvB
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGAAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10789 GenBank   NC_005911
Plasmid name   pAlvB Incompatibility group   -
Plasmid size   5216 bp Coordinate of oriT [Strand]   4130..4189 [+]
Host baterium   Hafnia alvei

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -