Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110353
Name   oriT_pAlvA in_silico
Organism   Hafnia alvei
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_005910 (4038..4097 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pAlvA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGTAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10788 GenBank   NC_005910
Plasmid name   pAlvA Incompatibility group   -
Plasmid size   5113 bp Coordinate of oriT [Strand]   4038..4097 [+]
Host baterium   Hafnia alvei

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -