Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110341
Name   oriT_pPL10 in_silico
Organism   Bacillus pumilus
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_001858 (527..550 [+], 24 nt)
oriT length   24 nt
IRs (inverted repeats)      1..7, 18..24  (ACCCCCC..GGGGGGT)
 3..8, 18..23  (CCCCCC..GGGGGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 24 nt

>oriT_pPL10
ACCCCCCCATGCTAACAGGGGGGT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10776 GenBank   NC_001858
Plasmid name   pPL10 Incompatibility group   -
Plasmid size   7028 bp Coordinate of oriT [Strand]   527..550 [+]
Host baterium   Bacillus pumilus

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -