Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110326 |
| Name | oriT1_DSM 103869|unnamed2  |
| Organism | Bacillus altitudinis strain DSM 103869 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP120623 ( 1442..1462 [-], 21 nt) |
| oriT length | 21 nt |
| IRs (inverted repeats) | 1..6, 16..21 (CCCCCC..GGGGGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 21 nt
>oriT1_DSM 103869|unnamed2
CCCCCCACTCTAACAGGGGGG
CCCCCCACTCTAACAGGGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10761 | GenBank | NZ_CP120623 |
| Plasmid name | DSM 103869|unnamed2 | Incompatibility group | - |
| Plasmid size | 8014 bp | Coordinate of oriT [Strand] | 5693..5713 [-]; 1442..1462 [-] |
| Host baterium | Bacillus altitudinis strain DSM 103869 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |