Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110313 |
| Name | oriT_FDAARGOS_714|unnamed2  |
| Organism | Shigella flexneri strain FDAARGOS_714 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055126 (2333..2420 [-], 88 nt) |
| oriT length | 88 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 88 nt
>oriT_FDAARGOS_714|unnamed2
GGGTGTCGGGGCGCAGCCCTGACCAGATGGCAAACGGAACATCGTCGTGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTT
GGGTGTCGGGGCGCAGCCCTGACCAGATGGCAAACGGAACATCGTCGTGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10748 | GenBank | NZ_CP055126 |
| Plasmid name | FDAARGOS_714|unnamed2 | Incompatibility group | Col |
| Plasmid size | 2783 bp | Coordinate of oriT [Strand] | 2333..2420 [-] |
| Host baterium | Shigella flexneri strain FDAARGOS_714 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |