Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110125 |
| Name | oriT_pHNLW22-3  |
| Organism | Klebsiella quasipneumoniae strain GLW9C22 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP089444 (1478..1527 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pHNLW22-3
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10560 | GenBank | NZ_CP089444 |
| Plasmid name | pHNLW22-3 | Incompatibility group | ColRNAI |
| Plasmid size | 4150 bp | Coordinate of oriT [Strand] | 1478..1527 [+] |
| Host baterium | Klebsiella quasipneumoniae strain GLW9C22 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |