Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   110078
Name   oriT_p921R in_silico
Organism   Enterobacter hormaechei subsp. steigerwaltii strain NMI921/19
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MZ750392 (19256..19354 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_p921R
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10513 GenBank   NZ_MZ750392
Plasmid name   p921R Incompatibility group   IncR
Plasmid size   51282 bp Coordinate of oriT [Strand]   19256..19354 [-]
Host baterium   Enterobacter hormaechei subsp. steigerwaltii strain NMI921/19

Cargo genes


Drug resistance gene   aph(3'')-Ib, aph(6)-Id, blaCTX-M-3, blaTEM-1B, blaNDM-1, qnrB1
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -