Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110077 |
| Name | oriT_pSF203-2 |
| Organism | Shigella flexneri 2b strain 203 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MW133273 (669..727 [-], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pSF203-2
GGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10512 | GenBank | NZ_MW133273 |
| Plasmid name | pSF203-2 | Incompatibility group | Col |
| Plasmid size | 1510 bp | Coordinate of oriT [Strand] | 669..727 [-] |
| Host baterium | Shigella flexneri 2b strain 203 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |