Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 110021 |
| Name | oriT_pCRNMS1-P3  |
| Organism | Citrobacter freundii strain CRNMS1 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP126538 (495..554 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pCRNMS1-P3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10456 | GenBank | NZ_CP126538 |
| Plasmid name | pCRNMS1-P3 | Incompatibility group | - |
| Plasmid size | 2175 bp | Coordinate of oriT [Strand] | 495..554 [-] |
| Host baterium | Citrobacter freundii strain CRNMS1 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |