Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109789 |
| Name | oriT_C. freundii 0|P7  |
| Organism | Citrobacter freundii isolate 0 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OW969911 (1375..1431 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_C. freundii 0|P7
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10224 | GenBank | NZ_OW969911 |
| Plasmid name | C. freundii 0|P7 | Incompatibility group | - |
| Plasmid size | 2195 bp | Coordinate of oriT [Strand] | 1375..1431 [-] |
| Host baterium | Citrobacter freundii isolate 0 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |