Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   109788
Name   oriT_C. freundii 0|P6 in_silico
Organism   Citrobacter freundii isolate 0
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OW969910 (2355..2414 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_C. freundii 0|P6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGTGCGCTAGCGCTGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10223 GenBank   NZ_OW969910
Plasmid name   C. freundii 0|P6 Incompatibility group   ColRNAI
Plasmid size   6653 bp Coordinate of oriT [Strand]   2355..2414 [+]
Host baterium   Citrobacter freundii isolate 0

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -