Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   109743
Name   oriT_145|P5 in_silico
Organism   Klebsiella oxytoca isolate 145
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OW967379 (10..69 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_145|P5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10178 GenBank   NZ_OW967379
Plasmid name   145|P5 Incompatibility group   Col440II
Plasmid size   5413 bp Coordinate of oriT [Strand]   10..69 [-]
Host baterium   Klebsiella oxytoca isolate 145

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -