Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109687 |
| Name | oriT_36|P1  |
| Organism | Klebsiella oxytoca isolate 36 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_OW969660 (150451..150500 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_36|P1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10122 | GenBank | NZ_OW969660 |
| Plasmid name | 36|P1 | Incompatibility group | IncFIB |
| Plasmid size | 165787 bp | Coordinate of oriT [Strand] | 150451..150500 [+] |
| Host baterium | Klebsiella oxytoca isolate 36 |
Cargo genes
| Drug resistance gene | blaTEM-1B |
| Virulence gene | - |
| Metal resistance gene | fecD, fecE, arsC, arsB, arsR, arsH, merE, merD, merA, merP, merR, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsA, arsD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |