Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109642 |
| Name | oriT_pRIVM_M036020_1  |
| Organism | Staphylococcus argenteus strain RIVM_M036020 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP086573 (1181..1369 [+], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 163..168, 178..183 (ATTTTA..TAAAAT) 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) 41..46, 48..53 (AAGTGT..ACACTT) 31..39, 44..52 (AGTGTCACA..TGTGACACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pRIVM_M036020_1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10077 | GenBank | NZ_CP086573 |
| Plasmid name | pRIVM_M036020_1 | Incompatibility group | - |
| Plasmid size | 20644 bp | Coordinate of oriT [Strand] | 1181..1369 [+] |
| Host baterium | Staphylococcus argenteus strain RIVM_M036020 |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |