Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109638
• Name: oriT1_20|unnamed1
• Organism: Yersinia pestis strain 20
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP084344 ( 3607..3666 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT1_20|unnamed1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 10073
• GenBank: NZ_CP084344
• Plasmid name: 20|unnamed1
• Incompatibility group: ColRNAI
• Plasmid size: 19159 bp
• Coordinate of oriT [Strand]: 13203..13262 [-]; 3607..3666 [-]
• Host baterium: Yersinia pestis strain 20

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -