Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109637
• Name: oriT_R|unnamed1
• Organism: Yersinia pestis strain R
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP084337 (123183..123242 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_R|unnamed1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 10072
• GenBank: NZ_CP084337
• Plasmid name: R|unnamed1
• Incompatibility group: IncFIB
• Plasmid size: 130936 bp
• Coordinate of oriT [Strand]: 123183..123242 [+]
• Host baterium: Yersinia pestis strain R

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -