Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109635
• Name: oriT_S19960127|pPCP
• Organism: Yersinia pestis strain S19960127
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP045638 (5008..5067 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_S19960127|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 10070
• GenBank: NZ_CP045638
• Plasmid name: S19960127|pPCP
• Incompatibility group: ColRNAI
• Plasmid size: 9607 bp
• Coordinate of oriT [Strand]: 5008..5067 [-]
• Host baterium: Yersinia pestis strain S19960127

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -