Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109629 |
| Name | oriT_Pestoides B|pPCP  |
| Organism | Yersinia pestis str. Pestoides B |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP010020 (8302..8361 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_Pestoides B|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10064 | GenBank | NZ_CP010020 |
| Plasmid name | Pestoides B|pPCP | Incompatibility group | ColRNAI |
| Plasmid size | 9606 bp | Coordinate of oriT [Strand] | 8302..8361 [-] |
| Host baterium | Yersinia pestis str. Pestoides B |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |