Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   109625
Name   oriT_A1122|pPCP in_silico
Organism   Yersinia pestis A1122
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP009839 (4242..4301 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_A1122|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   10060 GenBank   NZ_CP009839
Plasmid name   A1122|pPCP Incompatibility group   ColRNAI
Plasmid size   9612 bp Coordinate of oriT [Strand]   4242..4301 [+]
Host baterium   Yersinia pestis A1122

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -