Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109623
• Name: oriT_Shasta|pPCP
• Organism: Yersinia pestis strain Shasta
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP009724 (8994..9053 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_Shasta|pPCP
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 10058
• GenBank: NZ_CP009724
• Plasmid name: Shasta|pPCP
• Incompatibility group: -
• Plasmid size: 9364 bp
• Coordinate of oriT [Strand]: 8994..9053 [+]
• Host baterium: Yersinia pestis strain Shasta

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -