Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109593 |
| Name | oriT_E8440|9  |
| Organism | Enterococcus faecium isolate E8440 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LR135427 (131..307 [-], 177 nt) |
| oriT length | 177 nt |
| IRs (inverted repeats) | 91..97, 107..113 (ATTTTTT..AAAAAAT) 92..98, 105..111 (TTTTTTG..CAAAAAA) 28..34, 37..43 (CCTTCCT..AGGAAGG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 177 nt
>oriT_E8440|9
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGCGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
AAAGAGCATAAGGGAAAACTGATAGCACCTTCCTACAGGAAGGCGGCTAAGTCGGCTGTGCCAACTGGTTTTCTTACAAAACAACCTTATATTTTTTGATATCACAAAAAAATCCATTTTGGACCTATTTTCGGTCATAATATAGTACCTACTTTTGGTCATAGTTTCGTCCGTAGT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 10028 | GenBank | NZ_LR135427 |
| Plasmid name | E8440|9 | Incompatibility group | - |
| Plasmid size | 2056 bp | Coordinate of oriT [Strand] | 131..307 [-] |
| Host baterium | Enterococcus faecium isolate E8440 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |