Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109504 |
| Name | oriT_pSF422-2 |
| Organism | Shigella flexneri 1b strain 422 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MW133277 (759..818 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSF422-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 9939 | GenBank | NZ_MW133277 |
| Plasmid name | pSF422-2 | Incompatibility group | ColRNAI |
| Plasmid size | 6200 bp | Coordinate of oriT [Strand] | 759..818 [-] |
| Host baterium | Shigella flexneri 1b strain 422 |
Cargo genes
| Drug resistance gene | aph(6)-Id, aph(3'')-Ib, sul2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |