Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   109502
Name   oriT_pSF203-5 in_silico
Organism   Shigella flexneri 2b strain 203
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MW133281 (2240..2314 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pSF203-5
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   9937 GenBank   NZ_MW133281
Plasmid name   pSF203-5 Incompatibility group   ColRNAI
Plasmid size   2690 bp Coordinate of oriT [Strand]   2240..2314 [+]
Host baterium   Shigella flexneri 2b strain 203

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -