Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109498
• Name: oriT_pSF203-6
• Organism: Shigella flexneri 2b strain 203
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_MW133284 (839..898 [-], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pSF203-6
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 9933
• GenBank: NZ_MW133284
• Plasmid name: pSF203-6
• Incompatibility group: ColRNAI
• Plasmid size: 3460 bp
• Coordinate of oriT [Strand]: 839..898 [-]
• Host baterium: Shigella flexneri 2b strain 203

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -