Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 109497 |
Name | oriT_pSF149-6 |
Organism | Shigella flexneri 7a strain 149 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_MW133283 (839..898 [-], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSF149-6
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 9932 | GenBank | NZ_MW133283 |
Plasmid name | pSF149-6 | Incompatibility group | ColRNAI |
Plasmid size | 3460 bp | Coordinate of oriT [Strand] | 839..898 [-] |
Host baterium | Shigella flexneri 7a strain 149 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |