Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 109497 |
| Name | oriT_pSF149-6 |
| Organism | Shigella flexneri 7a strain 149 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MW133283 (839..898 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSF149-6
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 9932 | GenBank | NZ_MW133283 |
| Plasmid name | pSF149-6 | Incompatibility group | ColRNAI |
| Plasmid size | 3460 bp | Coordinate of oriT [Strand] | 839..898 [-] |
| Host baterium | Shigella flexneri 7a strain 149 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |