Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 109492
• Name: oriT_pSF422-3
• Organism: Shigella flexneri 1b strain 422
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_MW133282 (2240..2314 [+], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_pSF422-3
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 9927
• GenBank: NZ_MW133282
• Plasmid name: pSF422-3
• Incompatibility group: ColRNAI
• Plasmid size: 2690 bp
• Coordinate of oriT [Strand]: 2240..2314 [+]
• Host baterium: Shigella flexneri 1b strain 422

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -