Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   109492
Name   oriT_pSF422-3 in_silico
Organism   Shigella flexneri 1b strain 422
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MW133282 (2240..2314 [+], 75 nt)
oriT length   75 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 75 nt

>oriT_pSF422-3
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   9927 GenBank   NZ_MW133282
Plasmid name   pSF422-3 Incompatibility group   ColRNAI
Plasmid size   2690 bp Coordinate of oriT [Strand]   2240..2314 [+]
Host baterium   Shigella flexneri 1b strain 422

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -